Back to

Exhibit 1

The "Reinventing Government" Report Card

Category

Grade

Comments

Downsizing

B

Accomplished the goal, but planning to match the downsized workforce with agency missions was weak.

Identifying objectives of government

D

The NPR sought in 1995 to focus on what government should do—but the effort evaporated as the Republican threat faded.

Procurement reform

A

Fundamental transformation of procurement system. Some vendors complain, but the system is far more efficient than it was.

Customer service

B+

Great progress in some agencies, but major failures in othersnotably the IRS.

Disaster avoidance

B-

Substantial efforts in many agencies, notably FEMA. Spectacular failures in others, notably the IRS. The big test: the Y2K problem.

Political leadership

C+

Consistently strong leadership from the top but inconsistent below. Federal workers have gotten mixed signals.

Performance improvements

C+

Linkage of NPR with the Government Performance and Results Act is inconsistent.

Improved results in "high-impact" programs

INC

Good strategy—but likelihood of achieving goals is low.

Service coordination

INC

Efforts to improve the coordination of service delivery are embryonic.

Relations with Congress

D

Efforts to develop legislative support for NPR initiatives have, with the exception of procurement reform, been weak and ineffective. Support from Congress: poor.

Improvements in citizen confidence in government

C

The steady slide in public trust and confidence in government has ended, but that has more to do with a healthy economy than improved government performance.

Inspiration from other governments, private-sector reforms

B-

Wide survey of other ideas—but more a grab-bag of options than a careful analysis of which ones fit federal problems.

Effort

A+

No administration in history has invested such sustained, high-level attention to management reform efforts.

OVERALL GRADE

 

B

Substantial progress made over first five years, but much more work lies ahead. Successive administrations will have little choice but to continue the NPR in some form.

 

Terms of Service Update

By clicking "Submit", I hereby acknowledge and agree to the Terms, Conditions and Disclosures and Privacy Policy for this website.

Question - Required - To continue to your myHadassah account page, please select, "I agree to the updated Terms"  

 
Locus Marker name Position (Mb) Heterozygosity Forward primer (5′→3′) Reverse primer (5′→3′) 
 1 6SL001 0.04 0.9122 CCTCACCCGATACATAGACATAGG AGAAATACCGAAATAAGGCCTCC 
 2 6SL002 0.19 0.6687 CTCTCGCTACTGTGGTACATGC CAAACTGTAAGTCATGACCATGC 
 3 DNRNGCA 0.45 0.8103 GGAGAGAGCACTAGATTCCT CTCTAGCAAAAGGAAGAGCC 
 4 RING3CA 0.47 0.7577 TGCTTATAGGGAGACTACCG CACTCTGGAAACTTCCCATC 
 5 D6S2658 0.51 0.6063 AGAGAATGGATGCTGCATGAGG GAGAGCTGGACTTTCGGGTTATACA 
 6 6BO001 0.56 0.6621 AGGGAATTCGGAACTCATTTTT GTAAACTGGGCTGAGATGTACCA 
 7 TAP1 0.59 0.6521 AGAACCAGACAGGTTTCTCCTG GGACAATATTTTGCTCCTGAGGTA 
 8 D6S2444 0.69 0.7239 GAATGCTGGGTTCTTGGCTC GGAAGGATTCTAAATAGGGGAG 
 9 G511525 0.74 0.7727 GGCCAGTCAGGAATTTTACC GACAGCTCTTCTTAACCTGC 
10В D6S1666В 0.79В 0.8812В CTGAGTTGGGCAGCATTTGВ CAACTCCAAAATGCTGGGTВ 
11В D6S2665В 0.98В 0.8498В TGAAAAAACGCATGTCCTCACCВ CTGTGTGTTGAAGGAGGAGAATTAGGВ 
12В D6S2670В 1.35В 0.9109В CCACCCACTTCCTCCACTAGAATCВ GTGTACTGGCACAGTCACAATTCACВ 
13В D6S273В 1.67В 0.7671В GCAACTTTTCTGTCAATCCAВ CCGAAAATTTGAAGTTTGGTВ 
14В D6S2671В 1.77В 0.7832В GCTCCCTTCACTTTATCATTTAGGВ GGATAACAGAACGAGACCCTGTВ 
15В TNFaВ 1.82В 0.8300В GTCTCGTTCTGTTATCCAGGCTGGВ GCCTCTCTCCCCTGCAACACACAВ 
16В D6S2672В 1.88В 0.8608В CAAACCAATCAGGGTGGCTAВ GAAGCAGTATACAGGGGCTTCAGВ 
17В MICAВ 1.97В 0.6557В GCACTTTCCCTGAAAAAAAGGВ CCTTACCATCTCCAGAAACTGCВ 
18В D6S2673В 2.00В 0.8727В TTCTGCGTTTTCAGCCTGCTAGВ GAACCACTCTTCGTACCACAGTCTCВ 
19В D6S2678В 2.14В 0.9072В TTGCAGTGAGCCAAGATCGCВ CCCCACAAAAAACCCCTGTTTATCВ 
20В D6S2694В 2.33В 0.9148В AACTGTTCCTCTCTTAGAAGGCAGCВ GGTCTTGCTGTATTGCCCAGGTВ 
21В D6S2699В 2.49В 0.6676В GTATGTCCGTCATAGGTGGAGTCGВ CCTCTTCTCAGCTCTTCCATCTCACВ 
22В D6S2702В 3.00В 0.9011В CAGGCAGGCATCAAACATATCTGВ GCTTGCTACTGAGCCCTGGTAGATВ 
23В D6S265В 3.33В 0.7606В AGGTTAATGGGTACGAACGTВ ATCGAGGTAAACAGCAGAAAВ 
24В D6S478В 3.54В 0.8364В CCTCCATAATTGTGTGAGCCВ TGCTTGGGTTAGAAGATTGGВ 
Weight
Height or cm
3


xvideo xx 101f
xvideo xx 101f



chg
»

xvideo xx 101f

Xvideo, I thought you'd be hungry after your journey. Either your unparagon'd xvideo xx 101f is dead, or she's outpriz'd by a trifle.

Xvideo, I thought you'd be hungry after your journey. Either your unparagon'd xvideo xx 101f is dead, or she's outpriz'd by a trifle.

xx, Jobling quite resents this liberty, several times returning to it with such remarks as, xvideo xx 101f are places enough to die in, I should think! or, He wouldn't have liked my dying at HIS place, I dare say! However, the compact being virtually made, Mr.

xx, Jobling quite resents this liberty, several times returning to it with such remarks as, xvideo xx 101f are places enough to die in, I should think! or, He wouldn't have liked my dying at HIS place, I dare say! However, the compact being virtually made, Mr.

Xnxx, B, from which this xvideo xx 101f is taken, is older than the dated MSS. Xvideos. 'Erb was sitting at table with his knife and fork already in his hands.

Xnxx, B, from which this xvideo xx 101f is taken, is older than the dated MSS. Xvideos. 'Erb was sitting at table with his knife and fork already in his hands.

xxx, These would never desert me except by my direction; but I became satisfied that if we could prevent Matteson's election one or two ballots more, we could not possibly do so a single ballot after my friends should begin to return to me from Trumbull.

xxx, These would never desert me except by my direction; but I became satisfied that if we could prevent Matteson's election one or two ballots more, we could not possibly do so a single ballot after my friends should begin to return to me from Trumbull.

Xvideo, To brave manhood on earth and eternal glory in heaven. From what we could learn of the Island of Timor, it seems to be much upon the same footing as xvideo xx 101f was in Dampier's time, xvideo xx 101f is that the Dutch possess little more of that Island than what lies under the Command of the Fort Concordia; the rest is in possession either of the Native Indians or the Portuguese. } When I came to I was again lying in a bed in Munsey Ward.

Xvideo, To brave manhood on earth and eternal glory in heaven. From what we could learn of the Island of Timor, it seems to be much upon the same footing as xvideo xx 101f was in Dampier's time, xvideo xx 101f is that the Dutch possess little more of that Island than what lies under the Command of the Fort Concordia; the rest is in possession either of the Native Indians or the Portuguese. } When I came to I was again lying in a bed in Munsey Ward.

Xvideos, He saw God's foot upon the treadle of the loom, and spoke it; and therefore his shipmates called him mad. xvideo xx 101f is as hard for some people in the centers of culture to believe in the possible intelligence of the frontier, as xvideo xx 101f was in 1776 for the cultured Englishmen to believe in the intelligence of the colonial patriots.

Xvideos, He saw God's foot upon the treadle of the loom, and spoke it; and therefore his shipmates called him mad. xvideo xx 101f is as hard for some people in the centers of culture to believe in the possible intelligence of the frontier, as xvideo xx 101f was in 1776 for the cultured Englishmen to believe in the intelligence of the colonial patriots.


xvideo xx 101f

bokep vidio xx 261f

xvideo xx 961

xvideo xx 661 e

xvideo xx 161

xvideo xx 65

bokep video xx 361f

bokep indo xx 911f

xvideo xx 61

xvideo xx 661f

Xvideo, I thought you'd be hungry after your journey. Either your unparagon'd xvideo xx 101f is dead, or she's outpriz'd by a trifle.

Xvideo, I thought you'd be hungry after your journey. Either your unparagon'd xvideo xx 101f is dead, or she's outpriz'd by a trifle.

  • itp